graphpad prime (9.0.0) Search Results


99
Oxford Instruments resource source identifier software
Resource Source Identifier Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/resource source identifier software/product/Oxford Instruments
Average 99 stars, based on 1 article reviews
resource source identifier software - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
GraphPad Software Inc prime 9.0.0
Prime 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prime 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prime 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims version 9.0.0 for windows
Prims Version 9.0.0 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims version 9.0.0 for windows/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims version 9.0.0 for windows - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graph pad prim version 9.0.0
Graph Pad Prim Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graph pad prim version 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graph pad prim version 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims version 9.00
Prims Version 9.00, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims version 9.00/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims version 9.00 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prime (9.0.0)
Graphpad Prime (9.0.0), supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prime (9.0.0)/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prime (9.0.0) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism version 9.0.0
Prism Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism version 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism version 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims version 9.0.0
Prims Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims version 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims version 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prim 9.0.0
Graphpad Prim 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prim 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prim 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims 9 – version 9.0.0
Prims 9 – Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims 9 – version 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims 9 – version 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism 9.0.0
Graphpad Prism 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism 9.0.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism 9.0.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism7
KEY RESOURCES TABLE
Prism7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism7/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism7 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Striatal Projection Neurons Require Huntingtin for Synaptic Connectivity and Survival

doi: 10.1016/j.celrep.2019.12.069

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: MGI: 2177755 Oligonucleotides Htt Forward Primer: CAGGTCCGGCAGAGGAAC This Paper N/A Htt Reverse Primer: CATAGCGATGCCCAAGAGTT This Paper N/A pENK Forward Primer: GTTGTCTCCCGTTCCCAGTA This Paper N/A pENK Reverse Primer: GACAGCAGCAAACAGGATGA This Paper N/A Tac1 Forward Primer: TCGATGCCAACGATGATCTA This Paper N/A Tac1 Reverse Primer: AGCCTTTAACAGGGCCACTT This Paper N/A DARPP-32 Forward Primer: CCCAAAGTCGAAGAGACCCA This Paper N/A DARPP-32 Reverse Primer: CCGAAGCTCCCCTAACTCATC This Paper N/A Software and Algorithms Statistica StatSoft http://www.statsoft.com/Produ cts/STATISTICA-Features Prism7 GraphPad https://www.graphpad.com/scientiflc-software/prism/ Imaris 9.0.0 Oxford Instruments https://imaris.oxinst.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE Loss of Htt in striatal neurons recapitulates key features of Huntington’s disease Striatal neurons require Htt for survival during aging Deletion of Htt from striatal neurons disrupts synaptic connectivity

Techniques: Isolation, Reverse Transcription, Software